YÊU CẦU CÔNG NGHỆ
Vui lòng điền thông tin yêu cầu công nghệ để được tư vấn miễn phí
 
   
 
 

KẾT QUẢ TÌM KIẾM Hướng dẫn

Tìm thấy 38 kết quả.
  • Ứng dụng Hệ thống hội chẩn y tế trực tuyến Bách Khoa Tin tức

    Hệ thống hội chẩn trực tuyến Bách Khoa đã đuợc Sở Khoa học và Công nghệ TP.HCM nghiệm thu năm 2014, và bước đầu triển khai thí điểm tại Bệnh viện Nhân dân 115. Hiện nay, hệ thống đã đuợc triển khai rộng rãi tại các bện viện như: Bệnh viện Nhân dân Gia Định, Bệnh viện Thống Nhất, Trung tâm Y khoa Medic,…
  • Máy tạo oxy 5 lít JAY 5AW Công nghệ và Thiết bị

    - Máy tạo oxy đi động 5 lít JAY-5AW là dòng thiết bị tập trung oxy để chiết xuất oxy từ không khí trong khí quyển, nó thường sẽ có một rây phân tử chạy điện (zeolit nhân tạo) được sử dụng để tách nitơ từ không khí xung quanh. Nó có thể được áp dụng rộng rãi trong các bệnh viện ở cấp tất cả các mức độ khác nhau: phòng khám, trung tâm y tế, điều dưỡng tại gia đình, chăm sóc sức khỏe cho người già, những người lao động tri óc ,và sinh viên ...
  • Đầu dò E DNA theo cơ chế signal on giúp chẩn đoán ung thư hốc miệng Tìm kiếm đối tác

    Cảm biến sinh học là thiết bị phân tích đang thu hút được nhiều sự quan tâm nghiên cứu vì những tìm năng của nó trong việc chẩn đoán và phát hiện sớm nguy cơ ung thư.Tuy nhiên, phần lớn các cảm biến E-DNA hiện nay còn nhiều hạn chế về độ nhạy. Điều đó vẫn chưa đáp ứng được các yêu cầu của việc phát hiện sớm nguy cơ ung thư khi tiến hành thử trên các mẫu dịch cơ thể như nước bọt, máu…nhằm phát hiện các chỉ tố sinh học với một nồng độ cực thấp. Để tăng độ nhạy cho cảm biến điện hóa E-DNA có nhiều yếu tố một trong những yếu tố đó chính là cấu trúc của đầu dò. Đây là yếu tố giữ vai trò quan trọng và hầu hết được các nhóm nghiên cứu tập trung nghiên cứu để tăng độ nhạy cho cảm biến E-DNA. Trong nghiên cứu này chúng tôi đã nghiên cứu và thiết kế ra đầu dò DNA hoạt động theo cơ chế thay đổi tín hiệu signal-on, cố định trên bề mặt điện cực sợi nano vàng phủ trên đế Silic với mục tiêu phát hiện chỉ tồ Interleukin-8 trong mẫu nước bọt của bệnh nhân ung thư miệng, nhằm tăng độ nhạy cho cảm biến E-DNA.
     
    Vật liệu
    -Mục tiêu là sản phẩm của phản ứng RT-PCR (với cặp mồi IF: CCAAGGAAAACTGGGTGCAG và IR: TTGGATACCACAGAGAATGAATTTTT).
    -Từ mRNA của Interleukin-8 trong mẫu bệnh phẩm nước bọt của bệnh nhân mắc bệnh ung thư hốc miệng mà không cần trải qua quá trình tinh sạch gì thêm (được cung cấp bởi trung tâm Y sinh học phân tử, Đại học Y Dược Tp Hồ Chí Minh).
    -Trình tự của DNA mục tiêu: 5’-CCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAAAAAAATTCATTCTCTGTGGTATCCAAG-3’
    -Đầu dò DNA có cấu trúc kẹp tóc sau khi được thiết kế, được tổng hợp bởi Biosearch Technologies (Novato, CA).
    -Trình tự của đầu dò 5’-MB-TTTTTGAAGACCCGA-(CH2)6-S-S-(CH2)6- AGCCCTCTTCAAAAACTTCTCCACAACCCTCTGC-3’
    -Các dung dịch hóa chất 6-Mercaptohexanol (MCH), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP), postassium ferricyanide (K3Fe(CN)6), phosphate buffer saline (PBS) (pH 7.4) được cung cấp bởi (Sigma-Aldrich, St.Louis, MO). Nước cất khử ion 2 lần được sử dụng trong suốt quá trình thí nghiệm.
    -Điện cực vàng (AuNW) được sử dung là chíp các sơi nano vàng được phủ trên đế Silic với các thông số kỷ thuật (Dài: 1000µm; rộng: 2µm; cao: 60nm)
    Phương pháp
    - Chuẩn bị chíp và đầu dò
    - Chuẩn bị mục tiêu và lai hóa
    - Đo điện hóa
    Kết quả 
    Với mục đích thiết kế đầu dò có cấu trúc hoạt động theo cơ chế tín hiệu thay đổi signal-on, để gắn vào cảm biến E-DNA sợi nano vàng nhằm tăng độ nhạy cho cảm biến chúng tôi đã đạt được những kết quả sau. Thứ nhất thiết kế thành công đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on, có cấu trúc hairpin với trình tự nhằm phát hiện đoạn DNA là sản phẩm của phản ứng RT-PCR từ mRNA của Interleukin-8. Thứ hai giới hạn phát hiện (LOD) của cảm biến E-DNA sợi nano vàng khi được gắn đầu dò hoạt động theo cơ chế tín hiệu thay đổi signal-on thông qua phương pháp CV đạt được là 25pM. Và cuối cùng với LOD 25pM đã cho thấy sự thành công trong việc tăng độ nhạy cho cảm biến E-DNA có đầu dò hairpin so với cảm biến E-DNA có đầu dò cấu trúc stem-loop đạt LOD 200pM. Điều đó đã chứng minh rằng cảm biến E-DNA đầu dò hoạt động theo cơ chế signal-on có độ nhạy cao hơn cảm biến E-DNA có đầu dò hoạt động theo cơ chế signal-off.
     
  • Wash Up: Dịch vụ rửa xe tiện lợi vận dụng công nghệ Digital booking online Tìm kiếm đối tác

    Với mong muốn vận dụng giải pháp Digital và các công nghệ về tự động (Điện điện tử) để tối ưu hóa việc vận hành trong kinh doanh rửa, chăm sóc và giữ xe từ đó mang đến trải nghiệm mới giúp người tiêu dùng tiết kiệm thời gian. Giờ đây, việc rửa và chăm sóc xe của người dùng trở nên đơn giản hơn bao giờ hết, không còn phải vất vả mang xe đến tiệm và mất 15 – 20 phút ngồi chờ mà có thể chủ động đặt lịch trực tuyến, tranh thủ thời gian cà phê, làm việc tại văn phòng và tận hưởng cuộc sống.
     
    Tận dụng lợi thế từ trang thiết bị rửa xe khép kín, tinh gọn dễ dàng triển khai tại nhiểu điểm khác nhau tạo nên chiến lược phát triển thị trường khác biệt, dễ dàng mở rộng, khắc phục các vấn đề khó khăn của mô hình kinh doanh rửa xe truyền thống.
     
    Bằng sự am hiểu về Digital Marketing, chúng tôi mang đến một giải pháp tổng thể, lưu trữ dữ liệu khách hàng từ đó thúc đẩy các hoạt động sau bán hàng, tạo ra một hệ sinh thái khép kín cho các doanh nghiệp trong lĩnh vực: Phụ liệu chăm sóc xe – Sửa chữa xe – Rửa và giữ xe Nảy mầm ý tưởng từ một lần chờ đợi khi mang xe đi rửa giữa cái nắng nóng oi bức của trưa hè tháng 7 tại Sài Gòn của bạn Founder – Phạm Vũ, từng ý tưởng về sản phẩm, chiến lược kinh doanh của Wash-Up dần được hình thành dựa trên cơ sở khảo sát 300 người tiêu dùng tại khu vực HCM để thấu hiểu thói quen và nhu cầu rửa xe của người dùng.

    Trải qua hơn 11 tháng nghiên cứu với thành quả của những buổi đầu gian khổ là 05 mẫu thử nghiệm thất bại, có những lúc tưởng chừng như phải dừng hoạt động, đội ngũ thực hiện dự án Wash-Up vẫn kiên trì thử nghiệm, học hỏi để dần hình thành và hoàn chỉnh ra một khái niệm “Rửa xe tiện lợi”. Đợt khảo sát 100 khách hàng tại các cửa hàng cà phê The Coffee House mang lại kết quả 90% người hào hứng và muốn trải nghiệm dịch vụ Rửa xe tiện lợi chính là nền tảng, là cơ sở niềm tin để nhóm chính thức mang Wash-Up đến với người tiêu dùng. Với hơn 11 tháng hoàn thiện và lên kế hoạch bài bản để đảm bảo dự án được thành công, giảm thiểu rủi ro đầu tư, Wash-Up sẽ có các giai đoạn như : Softlaunch 1 tháng để đánh giá thị trường và quy trình dịch vụ, Chính thức launch với KPI 03 điểm bán mỗi tháng, đa dạng hóa kênh phân phối và chiến lược sản phẩm để chinh phục thị trường. Và chúng tôi rất mong muốn được có cơ hội để trình bày chi tiết chiến lược kinh doanh của mình đến các nhà đầu tư. Hãy liên hệ ngay với chúng tôi.

    Từ niềm đam mê kinh doanh, tôi luôn tìm tòi những ý tưởng kinh doanh từ Kinh doanh cà phê, Nhà hàng, Dịch vụ tổ chức sự kiện… cho đến khi bén duyên với ngành Rửa & Chăm sóc phương tiện cá nhân này và trực tiếp thực hiện khảo sát thị trường, tìm hiểu sâu hơn về ngành thì tôi nhận thấy đây thực sự là một cơ hội kinh doanh đầy tiềm năng với một thị trường đầy cơ hội (Chỉ riêng tại Tp. HCM đã có 7.5 triệu chiếc xe máy và hơn 650 ngàn ô tô) mức vốn đầu tư không lớn, khả năng xoay vòng vốn cao và tỉ suất lợi nhuận hấp dẫn không kém so với kinh doanh F&B. Đây chính là cơ hội và là mục tiêu để tôi thỏa niềm đam mê kinh doanh của mình cũng như là mang đến cơ hội đầu tư tốt cho các nhà đầu tư – những người chung chí hướng và đam mê kinh doanh với mình.
     
Sử dụng công nghệ sàn giao dịch Techport
Scroll